Tuesday, March 31, 2015

Human Variation and Race

Human Variation and Race 

High Levels of Solar Radiation

1. High Levels of Solar Radiation have been prove to have a negative impact on humans. The over exposition to this can have terrible effects in the human skin. One of the things that often have a terrible effect in the skin is the exposure to UVA rays. The ultraviolet radiation rays have the capacity to penetrate the many layers of the human skin. The over exposure to the UVA rays can create a lack of Vitamin B in the body, which later on would contribute to miscarriages, anemia or newborns with defects. The high levels of solar radiation can also affect Melanin, melanin is the component that controls the skin color. When this one is overly exposed to the sun it can created changes to the DNA. Cancer can be a result of such a changes. 

2. Short Terms: Sadly for short term adaptation their is really nothing the human body can do. We have poorly indication of when the body is been overly exposed to the sun. The only signs we can get are the sweet and the sensation of flush. 

Facultative: Tanning can be a facultative caused by the high levels of sola radiation. When we tan we tent to take a great amount of time to go back to our normal skin color. This is because when we expose our skin to the sun the UVA rays cause the human phenotypes to change making them darker. 

Developmental: The development in skin are found in the different type of environments humans are exposed to. Skin color is one of them. Depending in environment they are exposed to their skin color would change. People who are often exposed to the sun have darker skin, while people who are hardly ever exposed have lighter skin. The darker is skin is necessary for people who are born with it, since it helps them protect themselves from the UVA rays.

Cultural: There are plenty ways that humans have created ways to protect their skin from the solar rays. Often they wear long sleeves, protect themselves under an umbrella or hats. But the most common one is the use of sun block. Sun block helps to minimize the amount of rays that the skin is exposed to creating a better adaptation for humans to enjoy the outdoors. 

3. Studying the human variation can be really informative. We can learn what are the positive and the negative causes to the over exposure to the high levels of solar radiation. And we can also see how humans throughout the time have come to accustomed to it and how they now are trying to adapt to this. We can also learn the explanation of the different skin colors and their proposes. 


4. The term race is often used when someone is referring to someone’s skin color. Although if people pays close attention to the humans adaptation to their environment and their exposure to the solar radiation they could argue that race is not about skin color but their region; since the skin color has been adjusted to their environment in order for the individuals to survive. 

Tuesday, March 24, 2015

Language

Part I:

When I first read the instructions for this assignment I thought it would be a easy and not troublesome one, but as I proceeded to complete it, I discovered how death wrong I was. When I did the first part which consisted in 15 minutes of not talking, writing or using ASL as a way of communication, I felt like time couldn't go any faster and even frustrated. I had to remember myself really often that I couldn't answer. I'm a really talkative person, so I tent to have an answer or a comment for everything during a conversation and to not been able to do it, well that was really hard for me. My friends, who I was doing the experiment with, quickly noticed the change in my attitude and in various occasions asked if there was something, sadly they got nothing back as an answer. This however, didn't stop them from having their conversation, at this point it was obvious I was no longer in charge of the conversation; they tried changing topics or asking me questions to see if I would participate, but nothing worked. They eventually gave up and ignored my "attitude." At this point it was them who was in all charge of the conversation and I was just an outsider for them. If this experiment would have been a comparison between two cultures, in my opinion the one with the communication skills would have been the one with the advantage and the winner. In my life I have had similar experiences. An example of this was when I came to the U.S. from El Salvador. In that time I knew very little English, so I was often excluded from conversations because people made little effort into including me or I simply gave up since I didn't understand what they were saying. I feel that many people that come to a country where they don't share the same language as their native country find this disability for not been able to communicate quiet often.

Part II: 

The second part for this assignment was just as complicated as the first one. The difference was that, at least in part II, I could do use of my voice but, I was not allow to put any emotion or non-speech techniques. This only made me sound like a robot, emotionless to what I was saying. For this part of the assignment I failed terribly. Not even ten minutes into the activity and I was already altering my voice to make my point clear. The group of people that I did this part  with thought at some point that I was mad or irritated at them, and that I wasn't excited about the weekend. What I learned the most from this experienced is that non-speech language techniques are necessary to make a point clear or to demonstrate your actual feelings towards a situation. The variation in the voice, the facial expressions and the body language help the receiver understand what you are trying to say, making it easier for them to understand your feelings, needs and wants. The ability to be able to read body language is so important. Because someone might sound excited about something, but with their body language the receiver can really tell what are the feeling towards such. For example of someone doesn't really feel like going somewhere, but they still agree to go, you can notice their unhappiness in the situation in their facial expression (frown) or their body language (haunched back and shoulders) if you pay close attention you can tell that they are not happy, even if they are agreeing to attend. I feel that maybe one of the only times you can't not rely in the body language is when you are talking through the phone because you can't see them. 

Tuesday, March 10, 2015

Piltdown Hoax

The Piltdown Hoax is about the finding made by Charles Dawson in England, 1912. He declared to have found the remainders of an ancient human ancestor in the pit of Piltdown. This founding was quick to call the attention of the scientific community since during this time fossils were not known to be found in England. Instead they were more common to be found in Asia, France and Germany. His was what look like a piece of a skull, later on Dawson found the what turned to be the remains of a female ape jaw bone, what was strange of this fossil was that the ape possessed human teeth, something was never seeing before. This fossils were essential to make the connection between ancient human and apes, the scientific community thought it could be the missing link. During this time there was no questioning or doubting Dawson founds, he was trusted that he was been honest, but it wasn’t until 1950 that he's founding started to be questionable and with the new technology and methods created, the hoax was investigated. A British Museum  used the technique of Fluorine Analysis to demonstrate that piece of skull they had found was older than the jaw. The skull was probably around 100 years older. Creating a more deep investigation to the rest of the fossils. This investigation ended with the discovery that perhaps Dawson had dig the fossils there himself or someone else had done it. With the new advancement in technology many theories and many people have being put into doubt. Dawson is an example of it. When had just discovered the fossils his word was taken with no questioning, to just two 20 years later be questionable. Science is the fact, theory, always based on proof. But at the end is the facts that humans themselves can present. Because of this I think it’s hardly doable to remove human factor from science. What I learned from this, was that sometimes you can’t trust people until their proof has been verified. 

Wednesday, March 4, 2015

Comparative Primate

Lemurs: 
Mouse lemurs are a small in size species, they live in the forest of northern and eastern Madagascar, where there is over 100 different kinds of lemurs. This primates are small, which can be reflected in their dentition, their mandible and occlusal are only 5 cm. So you can get an idea of how tiny this animals really are. This is an adaptation for their diet. They don’t need a big mouth or teeth since they mostly feed out of fruit, flowers and leaves that they find in the forest. Because the weather on Madagascar is always changing, the mouse lemur keeps fat storage on their tails for when the temperatures decrease. 


Chimpanzee:
The Chimpanzees don’t have a specific habitat or environment, they can be found in many places of Africa. Their ancestors are the great apes and their evolution has happen to they can adjust to the forever evolving environment they are exposed to. Their mandible it’s about 3.25 cm, while the mandibular definition is of 1.75 cm. The chimpanzee often feed of vegetation or meat. 



Baboon: 
The baboon lives in the woodland savannas of Africa. This animals posses a mandible of 4 cm and a mandibular definition of labial and occlusal of 10 mm and a buccal of 2 cm, that come in play when they hunt smaller animals as part of their diet, but the also ate vegetation, they are polygamous  and in some cases they can be in groups of up to 30 individuals. 







Gibbon: 
The gibbons are asian apes, they are arboreal apes, which explains their long and strong arms. The gibbons have a mandible that can run from their caudal of 2.5 cm, clorsal of 1.75 cm, lateral 2.cm and a ventral of 1.75 cm. Their body is adapted to their environmental, always up in trees which also reflects their diet. They are omnivores. 


Spider Monkey: 
The spider monkey live in an environment of tropical rain forest, usually from the regions of Central, and South America, they have an small face and mouth, they are omnivores. 





What has come to my attention is how the environment affects the body size and diet of this primates. For the general part they were all in a vegetarian diet, which explains why most of this primates don't have big teeth. And the ones that do eat meat or hunt, are the ones with the bigger and stronger bodies. This primates live in a tropical forest or dry lands where there are trees. Hence they're long arms and their tails. This was something really interesting to learn, I learned about the dimensions of the mandible of most of this animals, which surprisingly enough the dimensions weren't that much different from each other. And either was the shape. The trait all of this primates share is one that has being passed down to each other as their time proceeds. 

Thursday, February 26, 2015

Homologous / Analogous Traits

Homology 
Gorillas and Humans 
The two different species that I have chosen are the gorillas and human tailbones. Also often referred to "vestigial." Humans are homosepians and gorillas are apes, but one thing that they have in common is the structure of the tailbone. Humans does not have a tail, but since the tailbone is the last vestige, it remains where the tail should be if there was one. Along evolution the tail structure has changed and evolve for humans, no longer looking like a tail, but as an extra bone. The ancestor who we shared this bone structure with is the Great Ape. 

Analogy 
Birds and Insects 
For this section I chose birds and insects wings. To be more specific I will be discussing the wings for butterflies. Birds are vertebras with warm blood; they have feathers and bones in their wings. Butterflies on the other hand are nectar feeding insects, they have a small body and really broad wings that contain a set of membranes which are filled with fluid. This two species do not share a common ancestor. The only thing they both have in common is that they both use their wings to fly. 

Thursday, February 19, 2015

Protein Synthesis

UCCCAUAUGUGGCAACUAUCGGUAUCAGUUUUUAACAGACAGACUUGCUGGACCUAGAGGGGU

Thursday, February 12, 2015

Natural Selection? Natural Selection.

One of the person's who influenced Darwin's Natural Selection theory was Alfred Russel Wallace. Just like Darwin, Wallace was working on his own theory about natural selection. Wallace sent his theory to Darwin in 1858, which came to Darwin as a surprise since it was very similar to his own, theory he had been developing since 1830. Both of their theories were published, although it was not well received at the time. Later own when their theory got recognized, it was Darwin the one to be more accredited for his theory. Nonetheless, Darwin and Wallace made a huge contribution to our understanding of the natural world. Wallace provided new information and evidence using warning colouration in animals as examples of natural selection, creating his own natural selection theory. Theory that was call The Wallace Effect. It occurs when natural selection favors reproductive isolation between two diverging populations, eventually creating two separate species x . Both Wallace and Darwin were committed to science, but their conceptions of science were dramatically different: for Wallace science was simply the search for truth in the natural world; for Darwin science must invoke only natural processes functioning via unbroken natural laws in non-teleological ways. Wallace’s view of science was unencumbered by philosophical assumptions whereas Darwin’s science was pigeonholed by the philosophical presumption known as methodological naturalism (or methodological materialism) x. 

With the knowledge and the different point of view that Darwin received from Wallace; he was able to follow and focus on his other processes, one that explained the evolution of particular characteristics such as the traits that were pass down during the evolution, but Wallace didn't seem to agree with this idea. Darwin didn't let this stop him, instead he focused one creating yet another important theory called sexual selection. Sexual selection focused on the evolution of many traits. One that related to one of the mechanism of natural selection, "In order for traits for natural selection to occur reproduction MUST occur!"

Many people might share the opinion that Darwin could of done his theory without the influence of the men who influenced him. But, more than influenced him, I think they inspired him to keep going and staying focus on his work. If he would of done it with no influence at all, his theory might not be the same since his ideas went back and forth often, having someone that shared similar ideas on natural selection helping to finish his master piece. With Wallace's help he finally formulated his now famous Natural Selection theory. 

When On the Origin of Species came out, one of the first people to turn it down was the church. They didn't agree with evolution based on the fact that, it was not the way human existence was explained in the bible. Darwin's theory for them was not real because for them the human existence was a creation by God and not by the product of science. The church made Darwin's revolutionary idea be seem as blasphemy. Opinion that didn't really seem to change throughout the years. Now Christians are free to choose whether they believe in the theory of evolution or not.